Operations

This section provides an overview on the different processing operations available in SEDA.

Based on the relation between input and output files, operations can be classified in two groups:

  • Those that process each input file to produce exactly one output file, which is a modified version of the input file: Filtering, Pattern filtering, Base presence filtering, Remove redundant sequences, Sort, Reallocate reference sequences, Rename header, Reformat file, Grow sequences, NCBI rename, Undo alignment, Disambiguate sequence names, Clustal Omega Alignment, Splign/Compart, ProSplign/ProCompart and getorf (EMBOSS).
  • Those that produce a different number of output files: Split, Merge, Consensus sequence, Concatenate sequences, Compare, and Blast.

BLAST

Blast

This operation allows to perform different BLAST queries using the selected FASTA files. Regarding the database to use in the queries, there are two possible modes: querying against all the selected FASTA files or querying against each FASTA file separately. Regarding the query, there are also two possibilities: using the sequences in one of the selected FASTA as queries or using the sequences in an external FASTA file as queries. When performing this operation, one blast query is executed for each sequence in the FASTA file.

The figure below illustrates the process followed when a query against all selected FASTA files is performed. Firstly, one blast database is created for each selected FASTA file. Then, one alias referencing to all the databases created before is created. Finally, each sequence in the FASTA file used as query source is executed against the alias. As a result, this mode creates as many output files as sequences in the FASTA file. To create these output files, the sequences where hits were found are retrieved from the database.

_images/19.png

On the other hand, the figure below shows the process followed when queries against each selected FASTA file are executed separately. Firstly, one blast database is created for each selected FASTA file. Then, each sequence in the FASTA file used as query source is executed against each of the databases. As a result, this mode creates as many output files as sequences in the FASTA file multiplied by the number of selected FASTA files. To create these output files, the sequences where hits were found are retrieved from the corresponding database.

_images/23.png

Configuration

First, the ‘Blast configuration’ area allows to select the execution mode of Blast: system binary indicates that blast will be executed directly using its binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the blast binaries (makeblastdb, blastdb_aliastool, blastdbcmd, blastp, blastn, blastx, tblastn, and tblastx) are located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute them.

_images/32.png

In the Docker image mode, the default image is already set, although it is possible to choose a custom one provided that it has the blast binaries in the system path.

_images/41.png

Then, the ‘DB configuration’ area allows to control some aspects related with the databases created in the process. The type of the database is automatically selected according to the blast type to execute. This area allows to indicate whether the databases and alias must be stored in a directory of your choice. Otherwise, temporary directories are used and they are deleted at the end of the process. Nevertheless, it may be interesting to store the databases for two reasons: use them again in SEDA or use them in BDBM (Blast DataBase Manager, http://www.sing-group.org/BDBM/). SEDA can reuse databases since if databases with the same name exist in the selected directory they are not created again.

_images/51.png

Finally, the ‘Query configuration’ area allows to control how queries are performed. As explained before, first you must choose the query mode in the ‘Query against’ parameter. Secondly, you must choose the blast type that you want to perform using the ‘Blast type’ parameter. By selecting the blast type: (i) the type of database is automatically determined, and (ii) if blastx or tblastn types are selected, then you will only be allowed to select a query from an external file because the selected files used to construct the database cannot be used as query (blastx uses a database of proteins and a query of nucleotides and tblastn uses a database of nucleotides and a query of proteins).

Thirdly, the ‘Query source’ allows to select the source of the query file:

  • From selected file: this option allows to select one of the selected files in SEDA using the ‘File query’ combobox.
  • From external file: this option allows to select an external FASTA file to be used as query file.

Then, three parameters allow to control the query execution:

  • Expectation value: the expectation value (E) threshold for saving hits.
  • Max. target. seqs: the maximum number of aligned sequences to keep.
  • Additional parameters: additional parameters for the blast command.

And finally, the ‘Extract only hit regions’ parameter allows to define how output sequences are obtained. By default, this option is not selected, meaning that the whole subject sequences where hits were found are used to construct the output FASTA files. If this option is selected, then only the part of the subject sequences where the hits were produced are used to construct the output FASTA files. Within this option, the ‘Hit regions window’ parameter allows to specify the number of bases before and after the hit region that should be retrieved.

_images/61.png

Blast: two-way ortholog identification

This operation allows to find the orthologs of a given sequence in a set of FASTA files. The figure below illustrates the process followed by this operation. For each sequence in a reference FASTA, this operation looks for its orthologs in the set of genomes. For each sequence in the reference FASTA, the following process is applied:

  1. A blast query against the first FASTA (hereafter, the reference FASTA) is performed using the reference sequence as query. Only the first hit is considered.

  2. The sequence associated to the first hit in the target FASTA is used as query in a second blast query against the reference FASTA. Again, only the first is considered.

  3. The sequence associated to the first hit in the reference FASTA is compared to the iteration sequence:

    1. If both sequences are the same, then the sequence found in step 2 is reported as ortholog.
    2. If both sequences are different, then the sequence found in step 2 is reported as ortholog if the Report non-exact orthologues is being used.
  4. Steps 1 to 3 are repeated for each target FASTA available.

_images/110.png

Configuration

First, the ‘Blast configuration’ area allows to select the execution mode of Blast: system binary indicates that blast will be executed directly using its binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the blast binaries (makeblastdb, blastdb_aliastool, blastdbcmd, blastp, blastn, blastx, tblastn, and tblastx) are located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute them.

_images/24.png

In the Docker image mode, the default image is already set, although it is possible to choose a custom one provided that it has the blast binaries in the system path.

_images/33.png

Then, the ‘DB configuration’ area allows to control some aspects related with the databases created in the process. The type of the database is automatically selected according to the blast type to execute. This area allows to indicate whether the databases must be stored in a directory of your choice. Otherwise, temporary directories are used and they are deleted at the end of the process. Nevertheless, you may be interested in storing the databases because SEDA can reuse them in the future: if databases with the same name exist in the selected directory they are not created again.

_images/42.png

Finally, the ‘Query configuration’ area allows to control how queries are performed. First, you can choose the ortholog report mode using the ‘Mode‘ parameter and choose ‘Report exact orthologues’ or ‘Report non-exact orthologues’. Secondly, you must choose the blast type that you want to perform using the ‘Blast type’ parameter. By selecting the blast type: (i) the type of database is automatically determined, and (ii) if blastx or tblastn types are selected, then you will only be allowed to select a query from an external file because the selected files used to construct the database cannot be used as query (blastx uses a database of proteins and a query of nucleotides and tblastn uses a database of nucleotides and a query of proteins).

Thirdly, the ‘Query source’ allows to select the source of the query file:

  • From selected file: this option allows to select one of the selected files in SEDA using the ‘File query’ combobox.
  • From external file: this option allows to select an external FASTA file to be used as query file.

And finally, two parameters allow to control the query execution:

  • Expectation value: the expectation value (E) threshold for saving hits.
  • Additional parameters: additional parameters for the blast command.
_images/52.png

Filtering

Base presence filtering

This operation allows filtering sequences based on the percentages of their bases (nucleotides or amino acids). By using the configuration panel shown below, you can add one or more bases and specify their minimum and maximum percentages. Sequences with bases whose percentage of presence is outside the specified thresholds are removed. Moreover, if you specify several bases in a single row then the sum of each percentage is used for checking the thresholds.

_images/111.png

Examples

Consider the following input FASTA file with two sequences:

Input:

>Sequence1
AAAAAACCCCCTTTGGGA
>Sequence2
AAAAAACCCTGGNNNNNN

The percentages of presence of sequence bases are:

  • Sequence1:
    • A: 0.38 (7/18)
    • C: 0.27(5/18)
    • T: 0.16 (3/18)
    • G: 0.16 (3/18)
  • Sequence2:
    • A: 0.33 (6/18)
    • C: 0.16 (3/18)
    • T: 0.05 (1/18)
    • G: 0.11 (2/18)
    • N: 0.33 (6/18)

For instance, to filter the input FASTA in order to obtain only those sequences with a percentage of A’s between 0.35 and 0.40, the following configuration should be used. In this case, only the first sequence will be in the output file.

_images/25.png

For instance, to filter the input FASTA in order to obtain only those sequences with a percentage of T’s or G’s between 0.10 and 0.20, the following configuration should be used. In this case, only the second sequence will be in the output file since the sum of T’s and G’s is 0.16 while in the first sequence is 0.32.

_images/34.png

Filtering

This operation allows filtering sequences based on different criteria (e.g. sequence length, non-multiple of three, or in-frame stop codons presence, among others).

The image below shows the configuration panel of the Filtering operation. If more than one option is selected, they are applied in the following order:

  1. Valid starting codons: filters sequences so that only those starting with the selected codons are kept.
  2. Remove stop codons: removes stop codons from the end of the sequences.
  3. Remove sequences with a non-multiple of three size: filters sequences so that only those having a length that is multiple of 3 are kept.
  4. Remove sequences with in-frame stop codons: filters sequences so that only those without in-frame stop codons are kept.
  5. Minimum sequence length: filters sequences so that only those with the specified minimum sequence length are kept. A value of 0 indicates that no minimum sequence length is required.
  6. Maximum sequence length: filters sequences so that only those with the specified maximum sequence length are kept. A value of 0 indicates that no minimum sequence length is required.
  7. If the header count filtering option is selected at the sequences level, then it filters sequences so that only those meeting the specified criteria regarding header counts are kept. See the examples to learn how to use this filter.
  8. Minimum number of sequences: filters files so that only those with the specified minimum number of sequences are kept.
  9. Maximum number of sequences: filters files so that only those with the specified maximum number of sequences are kept.
  10. If the header count filtering option is selected at the files level, then it filters files so that only those where all sequences meet the specified criteria regarding header counts are kept. See the examples to learn how to use this filter.
  11. Remove by size difference: filters sequences so that only those with the specified difference when compared to the reference sequence are kept.
  1. Maximum size difference (%): the maximum sequence length difference allowed expressed as a percentage.
  2. Reference sequence index: the index of the sequence to use as reference to compare to others. The first sequence corresponds to index 1. This option is ignored if a reference sequence file (next option) is selected.
  3. Reference sequence file: the file containing the sequence to use as reference to compare to others. If a file is selected, then the reference sequence index is ignored.
_images/112.png

Examples

Valid starting codons

By clicking on the ‘Codons‘ label, a list with the possible starting codons is shown, allowing to select one or more starting codons.

_images/26.png

The following example shows how the input FASTA is filtered to keep only those starting with ATG.

Input:

>Sequence1
TGCCAGAGAACTGCCGGTGTGGTG
>Sequence2
ATGTCTTCCATTAAGATTGAGTGT
>Sequence3
GCACCAGGGGGCCCTGTACTCCCT

Output:

>Sequence2
ATGTCTTCCATTAAGATTGAGTGT
Remove stop codons

The following example shows how sequences in the input FASTA are modified to remove stop codons from the end of the sequence. Note that this option actually modifies the input sequences.

Input:

>Sequence1
TTGCTCCCTACTCCTATGCGGGATGA
>Sequence2
TTGCTCCCTACTCCTATGCGGGATAA

Output:

>Sequence1
TTGCTCCCTACTCCTATGCGGGA
>Sequence2
TTGCTCCCTACTCCTATGCGGGA
Remove sequences with a non-multiple of three size

This example shows how sequences with a non-multiple of three size are removed from the input FASTA. Only Sequence1 and Sequence2, with 15 bases, appears in the output FASTA. Sequence3 is removed since it has 17 bases.

Input:

>Sequence1
CATTAAGATTGAGTG
>Sequence2
AATTAAGATTGAGAA
>Sequence3
CATTAAGATTGAGTGCTG

Output:

>Sequence1
CATTAAGATTGAGTG
>Sequence2
AATTAAGATTGAGAA
Remove sequences with in-frame stop codons

This example shows how sequences containing in-frame stop codons are removed from the input FASTA. Only Sequence2 does not contain in-frame stop codons, so that it is the only one in the output FASTA.

Input:

>Sequence1
CATTAAGATTGAGTG
>Sequence2
CATTCGGATTGAGTG

Output:

>Sequence2
CATTCGGATTGAGTG
Minimum sequence length

This example shows how sequences with a length below 7 are removed from the input FASTA. Thus, only “Sequence3”, with 15 bases, appears in the output FASTA. “Sequence1” and “Sequence2” are removed since they have 4 and 6 bases respectively.

Input:

>Sequence1
CATT
>Sequence2
CATTAT
>Sequence3
CATTAAGATTGAGTG

Output:

>Sequence3
CATTAAGATTGAGTG
Maximum sequence length

This example shows how sequences with a length above 5 are removed from the input FASTA. Thus, only Sequence1, with 4 bases, appears in the output FASTA. Sequence2 and Sequence3 are removed since they have 6 and 15 bases respectively.

Input:

>Sequence1
CATT
>Sequence2
CATTAT
>Sequence3
CATTAAGATTGAGTG

Output:

>Sequence1
CATT
Remove by size difference

This example shows how sequences with a length difference compared to the first sequence (Reference sequence index = 1) less than 10% are removed from the input FASTA. Sequence lengths and the differences compared to the reference sequence are:

  • Sequence1: 25 bases.
  • Sequence2: 24 bases. Difference: 1 → 1/25: 4%.
  • Sequence3: 23 bases. Difference: 2 → 2/25: 8%.
  • Sequence4: 22 bases. Difference: 3 → 3/25: 12%.
  • Sequence5: 21 bases. Difference: 4 → 4/25: 16%.

Thus, only Sequence1, Sequence2 and Sequence3 are kept in the output FASTA.

Input:

>Sequence1
TGCCAGAGAACTGCCGGTGTGGTGA
>Sequence2
TGCCAGAGAACTGCCGGTGTGGTA
>Sequence3
TCGCCAGCGCCCTCGGCCACACA
>Sequence4
TCGCCAGCGCCCTCGGCCACAA
>Sequence5
TCGCCAGCGCCCTCGGCCACA

Output:

>Sequence1
TGCCAGAGAACTGCCGGTGTGGTGA
>Sequence2
TGCCAGAGAACTGCCGGTGTGGTA
>Sequence3
TCGCCAGCGCCCTCGGCCACACA
Header count filtering (I)

This example shows how to use this filter in order to remove all sequences in the input FASTA whose sequence identifier appears exactly two times among all sequences.

_images/35.png

By using the configuration above, only Sequence1 and Sequence3 are kept in the output FASTA. If the same is applied at the files level, then the input FASTA would not appear in the output directory.

Input:

>Sequence1
TGCCAGAGAACTGCCGGTGTGGTGA
>Sequence1
TGCCAGAGAACTGCCGGTGTGGTGG
>Sequence2
AAAAACTGGAAAAAACTGGAAAACC
>Sequence3
TCGCCAGCGCCCTCGGCCACAGA
>Sequence3
TCGCCAGCGCCCTCGGCCACATG

Output:

Sequence1
TGCCAGAGAACTGCCGGTGTGGTGA
>Sequence1
TGCCAGAGAACTGCCGGTGTGGTGG
>Sequence3
TCGCCAGCGCCCTCGGCCACAGA
>Sequence3
TCGCCAGCGCCCTCGGCCACATG
Header count filtering (II)

This example shows how to use this filter in order to remove all sequences in the input FASTA for which a word defined by a regular expression does not appear one or two times.

Input:

>Homo_sapiens_1
TGCCAGAGAACTGCCGGTGTGGTGA
>Homo_sapiens_2
TGCCAGAGAACTGCCGGTGTGGTGG
>Homo_sapiens_3
AAAAACTGGAAAAAACTGGAAAACC
>Mus_musculus_1
TCGCCAGCGCCCTCGGCCACAGA
>Gallus_gallus_1
TCGCCAGCGCCCTCGGCCACATG
 >Gallus_gallus_2
TCGCCAGCGCCCTCGGCCACATG

By using the configuration below to filter the input FASTA above, the regular expression ^[^_]*_[^_]* splits the sequences in three groups:

  • Those containing Homo_sapiens: Homo_sapiens_1, Homo_sapiens_2, and Homo_sapiens_3.
  • Those containing Mus_musculus: Mus_musculus_1.
  • Those containing Gallus_gallus: Gallus_gallus_1 and Gallus_gallus_2.
_images/43.png

The operation filters the sequences so that only those for which their corresponding groups have a size between 1 and 2 are present in the output FASTA.

Output:

>Mus_musculus_1
TCGCCAGCGCCCTCGGCCACAGA
>Gallus_gallus_1
TCGCCAGCGCCCTCGGCCACATG
>Gallus_gallus_2
TCGCCAGCGCCCTCGGCCACATG

Pattern filtering

This operation allows to filter sequences based on a text pattern (note that this pattern can be also a regular expression, see section Pattern configuration for further details). Filtering can be applied to either sequence headers or the sequence content.

The image below shows the configuration panel of the Pattern filtering operation. This configuration panel allows to configure how the pattern filtering is applied:

  • Header or Sequence: check Sequence to look for the pattern on the sequence content or Header to look for the pattern on the sequence header.
  • Convert to amino acid sequence before pattern matching: when filtering sequences based on the sequence content, it is also possible to indicate that the sequences must be converted to amino acid sequences before applying the pattern. See below for further information on this configuration. Please note that nucleotide sequences containing ambiguity codes will not be translated generating an error.
  • Pattern: SEDA allows to define patterns in different ways. Refer to section Pattern configuration to learn how to create patterns.
_images/113.png

When filtering nucleotide sequences based on amino acid patterns, the ‘Convert to amino acid sequence before pattern matching option should be enabled. This option allows to configure the translation mode using the panel below.

_images/27.png

This panel allows to specify:

  • The frame in which translation should start. You can choose between:
    • Starting at fixed frame: by selecting this option, sequences are translated starting at the specified frame.
    • Considering frames 1, 2 and 3: by selecting this option, three translations starting at frames 1, 2 and 3 are created. This way, the pattern is applied to each translation separately and it is considered present if it is present in any of the translations.
      • If the ‘Join frames’ option is used, then the three translations are concatenated before testing the pattern. This is useful if a set of sequences is being processed and the composed pattern should be found in any of the frames, one part of the pattern being present in one frame and another part in a different frame, as in the case of intron containing gene sequences.
  • Use a custom codon code: this option allows selecting a file containing a custom DNA codon table. This option is unselected by default and in this case SEDA uses the standard genetic code. A custom codon code must be given in the following format:
TTT=T
CTT=C
GCA=A
  • Use reverse complement sequences: whether reverse complement of sequences is used before translation or not. If not selected, sequences are used as they are introduced.

Examples

The following example shows how an input FASTA is filtered to obtain only those sequences containing at least one ACTG.

Input:

>Sequence1
AGGGTTTAGCCAACTGCTGCAGCA
>Sequence2
AGGGTTTAGCCAACGCCTGCAGCA
>Sequence3
CTACTGGAATAGAACCTCTGGAAT
>Sequence4
CTATGGAATAGAACCTCTGGAATC

Output:

>Sequence1
AGGGTTTAGCCAACTGCTGCAGCA
>Sequence3
CTACTGGAATAGAACCTCTGGAAT

In the following example, sequences are filtered based on their headers. By using the pattern Homo_sapiens, only two sequences are kept in the output FASTA.

Input:

>Mus_musculus_1
TGCCAGAGAACTGCCGGTGTGGTG
>Homo_sapiens_1
ATGTCTTCCATTAAGATTGAGTGT
>Mus_musculus_2
GCACCAGGGGGCCCTGTACTCCCT
>Homo_sapiens_2
CGCGCAGCCGTCTTTGACCTTGAT

Output:

>Homo_sapiens_1
ATGTCTTCCATTAAGATTGAGTGT
>Homo_sapiens_2
CGCGCAGCCGTCTTTGACCTTGAT

Remove isoforms

This operation allows to detect and remove isoforms in each input FASTA file. This operation applies the following algorithm to detect and remove isoforms:

  1. Start with the first sequence (FS) and compare it against the remaining ones.
  2. For each pair of sequences (FS vs SS), it is considered that they are isoforms if they share a word of the specified length (Minimum word length).
  3. If they are isoforms, the second sequence (SS) is marked as isoform of the first sequence (FS) so that SS will not be taken for further comparisons.
  4. Repeat steps 1 to 3 for the remaining sequences.
  5. Now, for each group of isoforms, the Isoform selection criteria is applied to select which isoform should go to the output file.

This algorithm is applied to all sequences in each input FASTA file. Nevertheless, by using the Header matcher configuration, it is possible to split them in groups that will be processed separately. This option is meant for those scenarios where sequences from two or more species are mixed in the same FASTA file and this operation should be applied to each species separately.

The configuration panel allows to set the parameters of the operation:

  • Minimum word length: the minimum length of word to consider that two sequences are isoforms.

  • Isoform selection criteria: the configuration of the criteria to select which isoform should go to the output file.

    • Reference size: the isoform with the length closest to this reference size will be selected. In case of having two isoforms that are at the same distance, the tie break mode option allows specifying which one should be selected.
    • Tie break mode: shortest means that the sequence with less bases will be selected as isoform and longest means that the sequence with more bases will be selected as isoform.
  • Header matcher configuration: this option allows to specify whether sequences must be grouped before the identification of the isoforms. Leave it empty if isoforms must be removed at a file level. In contrast, if you want to make groups of sequences before the identification of the isoforms, here it is possible to configure how sequence headers must be matched in order to group sequences. Check the manual for examples.

    • String to match: the regular expression that must be matched in the sequence header.
    • Case sensitive?: whether the string must be matched as case sensitive or not.
    • Quote pattern?: whether the regular expression pattern must be quoted or not. When the regular expression is quoted, metacharacters or escape sequences in it will be given no special meaning.
    • Regex group?: the regular expression group that must be extracted. Default value is 0, meaning that the entire result must be considered. Use values higher than 0 when there are brackets in the regular expression in order to select the desired group.
    • Header target?: the part of the sequence header where the string must be found.
  • Removed isoforms: this group of options allows to specify how removed isoforms should be processed.

    • Add removed isoform headers?: whether the removed isoform headers should be added to the header of the selected isoform.
    • Header target: the part of the removed isoform headers that should be added.
    • Isoform files directory: whether the removed isoform names should be saved into a CSV file or not. This allows an easy identification of those sequences that had isoforms in the output files. If you do not want to save them, leave this file empty. Otherwise, choose the directory where such files should be created.
_images/114.png

Examples

The following example illustrates how isoforms in the input FASTA file are removed so that the output FASTA only contains those with a sequence length closest to a Reference size of 10. The Minimum word length is 8.

Input:

>S1 [Size 10]
AAAAATTTTT
>S2 [Size 8]
AAAATTTT
>S3 [Size 6]
AAATTT
>S4 [Size 12]
TTTTTTGGGGGG
>S5 [Size 10]
TTTTTGGGGG

Output:

>S1 [Size 10]
AAAAATTTTT
>S3 [Size 6]
AAATTT
>S5 [Size 10]
TTTTTGGGGG

As explained before, the Header matcher configuration allows to split the input sequences in groups that will be processed separately. This option is meant for those scenarios where sequences from two or more species are mixed in the same FASTA file and this operation should be applied to each species separately. Consider the input FASTA below that contains sequences from both Homo sapiens and Mus musculus. When it is processed using the configuration below, the output FASTA is obtained.

_images/28.png

Note how the Mus_musculus_3 sequence is present in the output file although, without knowing its origin it could have been considered an isoform of the Homo_sapiens_1 sequence. This is because the regular expression ^[^_]*_[^_]* splits the sequences in two groups: those containing Homo_sapiens and those containing Mus_musculus, which are processed separately.

>Homo_sapiens_1 [Size 10]
AAAAATTTTT
>Homo_sapiens_2 [Size 8]
AAAATTTT
>Mus_musculus_1 [Size 12]
TTTTTTGGGGGG
>Mus_musculus_2 [Size 10]
TTTTTGGGGG
>Mus_musculus_3 [Size 12]
AAAAAATTTTTT

Output:

>Homo_sapiens_1 [Size 10]
AAAAATTTTT
>Mus_musculus_2 [Size 10]
TTTTTGGGGG
>Mus_musculus_3 [Size 12]
AAAAAATTTTTT

Output (selecting also the Add remove isoform headers option):

>Homo_sapiens_1 [Size 10] [Homo_sapiens_2, Mus_musculus_3]
AAAAATTTTT
>Mus_musculus_2 [Size 10] [Mus_musculus_1]
TTTTTGGGGG

Remove redundant sequences

This operation allows removing redundant sequences. Redundant sequences are sequences with exactly the same sequence bases. If the ‘Remove also subsequences’ option is selected, then sequences contained within larger sequences are also removed.

_images/115.png

Option ‘Merge headers’ allows controlling how new sequences are created. If this option is not selected, then the header of the new sequence is the header of one of the two being merged. On the contrary, if this option is selected, the header of the new sequence is created by concatenating the headers of the two sequences being merged. You can also save a report of the merged headers into a file by selecting the ‘Save merged headers into a file’.

When removing redundant sequences, it is also possible to indicate that the sequences must be converted to amino acid sequences before checking if they are redundant. This way, it is possible to filter nucleic acid sequences based on amino acid patterns. To do so, the ‘Convert to amino acid sequence before sequence comparison’ option should be enabled. Please note that nucleotide sequences containing ambiguity codes will not be translated generating an error. This option allows to configure the translation mode using the panel below.

_images/29.png

This panel allows to specify:

  • The frame in which translation should start. You can choose between:
    • Starting at fixed frame: by selecting this option, sequences are translated starting at the specified frame.
    • Considering frames 1, 2 and 3: by selecting this option, three translations starting at frames 1, 2 and 3 are created. This way, each translation is tested separately and the sequence is considered redundant if any of the three frames is redundant.
  • Use a custom codon code: this option allows selecting a file containing a custom DNA codon table. This option is unselected by default and in this case SEDA uses the standard genetic code. A custom codon code must be given in the following format:
TTT=T
CTT=C
GCA=A
  • Use reverse complement sequences: whether reverse complement of sequences is used before translation or not. If not selected, sequences are used as they are introduced.

Examples

The following example shows how only exact sequences are removed. Since Sequence1 and Sequence2 have the same nucleotide sequence, they are combined in the output FASTA. The ‘Merge headers’ is selected to illustrate how sequence headers are combined.

Input:

>Sequence1
ATGGTCCATGGGTACAAAGGGGT
>Sequence2
ATGGTCCATGGGTACAAAGGGGT
>Sequence3
CCATGGGTACA

Output:

>Sequence1 [Sequence2]
ATGGTCCATGGGTACAAAGGGGT
>Sequence3
CCATGGGTACA

The following example shows how both exact sequences and subsequences are removed. Since Sequence1 and Sequence2 have the same nucleotide sequence, they are combined in the output FASTA. Sequence3 is also combined with the previous combination because CCATGGGTACA is contained in it.

Input:

>Sequence1
ATGGTCCATGGGTACAAAGGGGT
>Sequence2
ATGGTCCATGGGTACAAAGGGGT
>Sequence3
CCATGGGTACA

Output:

>Sequence1 [Sequence2] [Sequence3]
ATGGTCCATGGGTACAAAGGGGT

Gene Annotation

Augustus (SAPP)

This operation allows to annotate a eukaryotic genome or sequence of interest by predicting genes using Augustus (https://sapp.gitlab.io/eukaryote/).

Important

This operation fails when the input FASTA file contains duplicated sequence identifiers. If so, process the input FASTA files first using the Disambiguate sequence names operation to make sure that sequence identifiers are unique.

Configuration

First, the ’SAPP configuration’ area allows to select the execution mode of SAPP: system binary indicates that SAPP will be executed directly using its binaries (i.e. the required jar files) and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the SAPP binaries (Conversion.jar and genecaller.jar) are located must be specified (refer to section Dependencies for additional information about this). It is also possible to specify the path to the Java binary, although by default the Java that comes with SEDA is used. Click the ‘Check SAPP jars’ button to make sure that SEDA can correctly execute them.

_images/116.png

Secondly, the ’bedtools configuration’ area allows to select the execution mode of bedtools: system binary indicates that bedtools will be executed directly using its binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the bedtools binary is located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute it.

_images/210.png

In the Docker image mode, the default image is already set, although it is possible to choose a custom one provided that it has the bedtools binary in the system path.

Finally, the remaining options in the configuration panel also allows to choose the following specific settings of the SAPP program:

  • Species: the species to use.
_images/36.png

getorf (EMBOSS)

This operation allows to find and extract open reading frames (ORFs) using the getorf program from the EMBOSS suite. According to its manual (http://emboss.sourceforge.net/apps/cvs/emboss/apps/getorf.html):

“This program finds and outputs the sequences of open reading frames (ORFs) in one or more nucleotide sequences. An ORF may be defined as a region of a specified minimum size between two STOP codons, or between a START and a STOP codon. The ORFs can be output as the nucleotide sequence or as the protein translation. Optionally, the program will output the region around the START codon, the first STOP codon, or the final STOP codon of an ORF. The START and STOP codons are defined in a Genetic Code table; a suitable table can be selected for the organism you are investigating. The output is a sequence file containing predicted open reading frames longer than the minimum size, which defaults to 30 bases (i.e. 10 amino acids).”

Configuration

First, the ’EMBOSS configuration’ area allows to select the execution mode of EMBOSS: system binary indicates that EMBOSS will be executed directly using its binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the EMBOSS binaries (e.g. getorf) are located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute them.

_images/117.png

Finally, the remaining options in the configuration panel also allows to choose the following specific settings of the getorf program:

  • Table: the code to use.
  • Find: the first four options are to select either the protein translation or original nucleic acid sequence of the reading frame. There are two definitions of an open reading frame: it either be a region that is free of codons or a region that begins with a codon and ends with a STOP codon. The three options are probably only of to people who wish to investigate statistical properties of the regions potential START or STOP codons. The option assumes that ORF are calculated between two STOP codons.
  • Min. size: the minimum nucleotide size of ORF to report (any integer value).
  • Max. size: the maximum nucleotide size of ORF to report (any integer value).
  • Additional parameters: additional parameters for the getorf program.
_images/211.png

ProSplign/ProCompart Pipeline

This operation allows to obtain CDS annotations using the selected FASTA files as reference proteing sequences with ProSplign/ProCompart. This operation applies the procedure described here (https://www.ncbi.nlm.nih.gov/sutils/static/prosplign/prosplign.html) to each selected FASTA file as nucleotide subject file.

ProSplign/ProCompart can be seen as an alternative to Splign/Compart. When using this operation, protein reference sequences rather than CDSs (nucleotide) reference sequences are used. Since protein sequences change at a slower pace than nucleotide sequences, in principle the reference and target sequences can be more distantly related than when using the Splign/Compart option, but it is difficult to quantify how distantly related they can be. Moreover, Splign/Compart runs considerably faster than ProSplign/ProCompart. The resulting CDS annotation is based on the homology to a given protein reference sequence, and thus may produce sequence annotations with lengths that are not multiple of three, if for instance, sequencing errors causing frameshifts are present in the genome to be annotated. Nevertheless, the existence of intron splicing signals at the exons 5’ and 3’ ends is taken into account. There will be no stop codon in the CDS annotation since the reference sequence is a protein.

Configuration

First, the ‘ProSplign/ProCompart configuration’ area allows to select the execution mode of ProSplign/ProCompart: system binary indicates that they will be executed directly using their binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the required binaries (prosplign and procompart-wrapper) are located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute them.

_images/118.png

In the Docker image mode, the default image is already set, although it is possible to choose a custom one provided that it has the ProSplign/ProCompart binaries in the system path.

Secondly, the ‘Blast configuration’ area allows to select the execution mode of Blast: system binary indicates that blast will be executed directly using its binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the blast binaries (makeblastdb, blastdb_aliastool, blastdbcmd, blastp, blastn, blastx, tblastn, and tblastx) are located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute them.

_images/212.png

In the Docker image mode, the default image is already set, although it is possible to choose a custom one provided that it has the blast binaries in the system path.

Finally, the configuration panel also allows to choose:

  • External file query: the query file (proteins).
  • Max. target seqs.: value of the max_target_seqs BLAST parameter.
_images/37.png

Test data

This operation can be tested using the test data available here (https://www.sing-group.org/seda/downloads/data/test-data-prosplign-procompart.zip). First, the ‘Demo_Genome_Nucleotides.fa‘ file should be selected using the SEDA Input area. Then, the ‘Demo_Query_Protein.fa‘ file should be selected in the configuration panel of the operation as External file query. This operation produces a FASTA file like the one at the ‘Expected_Demo_ProSplign_Compart_Results.fa‘.

In addition, this operation can be also tested using the data of this use case (https://www.sing-group.org/BDBM/usecases.html#uc7) of our BDBM software, which has the goal of obtaining the Nicotiana attenuata PPCK1a CDS, using the Solanum tuberosum PPCK1a protein sequence (AF531415) as the reference.

Splign/Compart Pipeline

This operation allows to annotate exons or genes, as long as a CDS reference sequence is available from a closely related species. How closely related the species must be depends on how fast the gene(s) in question evolve. For instance, a few highly conserved Drosophila virilis genes can be annotated this way using as reference Drosophila melanogaster CDSs (the common ancestor of the two species lived more than 40 million years ago). Each selected FASTA file is used as target and an external file with CDS must be provided in the operation configuration.

Configuration

First, the ‘Splign/Compart configuration’ area allows to select the execution mode of Splign/Compart: system binary indicates that they will be executed directly using their binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the required binaries (splign and compart) are located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute them.

_images/119.png

In the Docker image mode, the default image is already set, although it is possible to choose a custom one provided that it has the Splign/Compart binaries in the system path.

Secondly, the ‘Blast configuration’ area allows to select the execution mode of Blast: system binary indicates that blast will be executed directly using its binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the blast binaries (makeblastdb, blastdb_aliastool, blastdbcmd, blastp, blastn, blastx, tblastn, and tblastx) are located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute them.

_images/213.png

In the Docker image mode, the default image is already set, although it is possible to choose a custom one provided that it has the blast binaries in the system path.

Thirdly, the ’bedtools configuration’ area allows to select the execution mode of bedtools: system binary indicates that bedtools will be executed directly using its binaries and Docker image means that a Docker image will be used instead.

In the system binary mode, the path where the bedtools binary is located must be specified (refer to section Dependencies for additional information about this). If they are available in the system path, just click the ‘Check binary’ button to make sure that SEDA can correctly execute it.

_images/38.png

In the Docker image mode, the default image is already set, although it is possible to choose a custom one provided that it has the bedtools binary in the system path.

Finally, the configuration panel also allows to choose:

  • External file query: the CDS query file (nucleotides).
  • Concatenate exons?: if this option is checked then adjacent exons will be concatenated. Therefore, if an annotation is obtained for every exon of a given gene, the resulting sequence will be the complete CDS.
_images/44.png

Test data

This operation can be tested using the test data available here (https://www.sing-group.org/seda/downloads/data/test-data-splign-compart.zip), which is the data of this use case (https://www.sing-group.org/BDBM/usecases.html#uc3) of our BDBM software. First, the ‘dsim-all-chromosome-r2.02.fasta‘ file should be selected using the SEDA Input area. Then, the ‘dmel-sod.fasta‘ file should be selected in the configuration panel of the operation as External file query. This operation produces a FASTA file like the one at the ‘seda-output-concatenated.fasta‘ when the Concatenate exons? option is selected and a FASTA like the one at the ‘seda-output-without-concatenation.fasta‘ when the Concatenate exons? option is not selected.

General

Compare

This operation allows to make all the possible pairwise comparisons on the input files.

The configuration panel allows to choose the Sequence target, which is the part of the sequences that must be used to compare them, and also the Reformat output file settings, which allows to specify the format parameters of the output FASTA files containing the comparison results (see section Reformat file to learn more about this formatting).

_images/120.png

Examples

The following example shows how the two input FASTA files are compared using the nucleotide sequence as Sequence target.

Input1:

>Sequence1
ACTG
>Sequence2
TCGA
>Sequence3
TTAA
>Sequence6
AAAA

Input2:

>Sequence1
ACTG
>Sequence4
GGTT
>Sequence5
GTCA
>Sequence6
AAAA

Input1_vs_Input2_both.fasta:

>Sequence1
ACTG
>Sequence6
AAAA

Input1_vs_Input2_only_Input1.fasta

>Sequence2
TCGA
>Sequence3
TTAA

Input1_vs_Input2_only_Input2.fasta

>Sequence4
GGTT
>Sequence5
GTCA

Grow sequences

This operation allows to grow sequences by merging those sequences with the specified ‘Minimum overlapping’ bases.

_images/121.png

This operation applies the following algorithm to merge sequences:

  1. Use the first sequence as reference sequence.
  2. Compare the reference sequence to the rest of sequences. For each pair of sequences, check if there is an overlapping of bases of at least the minimum size specified. This overlapping is searched at the beginning of the reference sequence and at the ending of the sequence being compared.
  1. If an overlapping is found, merge the two sequences. The merged sequences are removed from the set of sequences and the new one is added. Return to step 1.
  2. If an overlapping is not found between the first reference sequence and the rest of sequences, then step 2 is repeated for the rest of sequences repeatedly.
  1. The process stops when all sequences have been compared without merging any of them.

Examples

The following example shows how sequences with a minimum overlapping of 6 in the input FASTA are merged. Sequence1 and Sequence2 have an overlapping region of 9 bases (CTCTCTCTC), thus they are merged in the output FASTA.

Input:

>Sequence1
AAAAAGGCTCTCTCTC
>Sequence2
CTCTCTCTCGGGGGGG
>Sequence3
ACTGACTGAAAAA

Output:

>Sequence3
ACTGACTGAAAAA
>Sequence2 [Sequence1]
AAAAAGGCTCTCTCTC
GGGGGGG

The following example shows how sequences with a minimum overlapping of 4 in the input FASTA are merged. Sequence1 and Sequence3 have an overlapping region of 5 bases (AAAAA) in the highlighted area, thus they are merged in the first place. Then, the resulting sequence has an overlapping region of 8 bases with Sequence2, thus there is only one sequence in the output FASTA.

Input:

>Sequence1
AAAAAGGCTCTCTCTC
>Sequence2
CTCTCTCTCGGGGGGG
>Sequence3
ACTGACTGAAAAA

Output:

>Sequence2 [Sequence1 [Sequence3]]
ACTGACTGAAAAAGGCTCTCTCTCGGGGGGG

Merge

This operation allows to merge all the selected input FASTA files into a single output FASTA. The ‘Name’ parameter defines the name for the output file. Additionally, you can specify the FASTA format parameters in the ‘Reformat output file’ area (see section Reformat file to learn more about this formatting).

_images/122.png

The following example illustrates how input FASTA files 1 and 2 are merged into a single output FASTA file without line breaks.

Input 1:

>Homo_sapiens_1
ACTG
ACTG
>Homo_sapiens_2
ACTG
ACTG

Input 2:

>Mus_musculus_1
ACTG
ACTG
>Mus_musculus_2
ACTG
ACTG

Output:

>Homo_sapiens_1
ACTGACTG
>Homo_sapiens_2
ACTGACTG
>Mus_musculus_1
ACTGACTG
>Mus_musculus_2
ACTGACTG

Regular expression split

This operation allows to split each input FASTA file based on regular expression patterns. This operation matches the defined regular expression pattern against the sequence headers to make groups using the matching parts.

The configuration panel allows to set the parameters of the operation:

  • Group names files directory: whether the groups created for each file should be saved into a TXT file or not. This allows an easy identification of the sequence groups that have been created. If you do not want to save them, leave this file empty. Otherwise choose the directory where such files should be created.

  • Header matcher configuration: this option allows to specify how sequences must be grouped to form the new files.

    • String to match: the regular expression that must be matched in the sequence header.
    • Case sensitive?: whether the string must be matched as case sensitive or not.
    • Quote pattern?: whether the regular expression pattern must be quoted or not. When the regular expression is quoted, metacharacters or escape sequences in it will be given no special meaning.
    • Regex group?: the regular expression group that must be extracted. Default value is 0, meaning that the entire result must be considered. Use values higher than 0 when there are brackets in the regular expression in order to select the desired group.
    • Header target?: the part of the sequence header where the string must be found.
_images/123.png

Examples

This is a powerful option that allows complex splits. For instance, it can be used in those scenarios where sequences from two or more species are mixed in the same FASTA file and one FASTA file per species is wanted. Consider the input FASTA below that contains sequences from three species: Homo sapiens, Gallus gallus, and Mus musculus. When it is processed using the configuration below, three output FASTA files are obtained. Basically, the regular expression ^[^_]*_[^_]* is able to extract the common species names from the headers so that sequences are grouped based in them.

_images/214.png
>Homo_sapiens_1
AAAAATTTTT
>Homo_sapiens_2
AAAATTTT
>Mus_musculus_1
TTTTTTGGGGGG
>Mus_musculus_2
TTTTTGGGGG
>Gallus_gallus_1
AAAAAATTTTTT
>Gallus_gallus_2
TTTTTGGGGG

Output FASTA Gallus_gallus:

>Gallus_gallus_1
AAAAAATTTTTT
>Gallus_gallus_2
TTTTTGGGGG

Output FASTA Homo_sapiens:

>Homo_sapiens_1
AAAAATTTTT
>Homo_sapiens_2
AAAATTTT

Output FASTA Mus_musculus:

>Mus_musculus_1
TTTTTTGGGGGG
>Mus_musculus_2
TTTTTGGGGG

In addition, if a folder is selected in the Group names files directory option, it is ceated the following file containing the list of matches obtained for this FASTA file:

Homo_sapiens
Mus_musculus
Gallus_gallus

Split

This operation allows to split each input FASTA file into several FASTA files. The ‘Split mode’ parameter defines the way of splitting them:

  • Fixed number of sequences per file: it divides each input FASTA into several files containing the defined ‘Number of sequences’ in each one.
  • Fixed number of files: it divides each input FASTA into the defined ‘Number of files’ with the same number of sequences in each one.
  • Fixed number of sequences per defined number of files: it divides each input FASTA into the defined ‘Number of files’ containing the defined ‘Number of sequences’ in each one. In this mode, the result of multiplying ‘Number of files’ by ‘Number of sequences’ should be less or equal to the number of sequences contained in the input FASTA file being processed. Nevertheless, in some occasions it may be necessary to do that. The option ‘Independent extractions’ allows doing this. See the examples section to see how this option works in detail.
_images/124.png

In addition, if the ‘Randomize’ option is selected, sequences in the input FASTA are sorted in a random order before producing the output FASTA files. The ‘Seed’ number specifies the random seed to set before shuffling the sequences. This allows the same result to be reproduced in different runs and environments with same random seed.

Examples

Fixed number of sequences per file

The following example shows how to split an input FASTA file containing 5 sequences into files containing 2 sequences. Three output FASTA are created: two containing the specified number of sequences (2 sequences) and one containing the remaining (1 sequence).

Input:

>Sequence1
ACTG
>Sequence2
ACTGACTG
>Sequence3
ACTGACTGACTG
>Sequence4
ACTGACTGACTGACTG
>Sequence5
ACTGACTGACTGACTGACTG

Output 1:

>Sequence1
ACTG
>Sequence2
ACTGACTG

Output 2:

>Sequence3
ACTGACTGACTG
>Sequence4
ACTGACTGACTGACTG

Output 3:

>Sequence5
ACTGACTGACTGACTGACTG
Fixed number of files

The following example shows how to split an input FASTA file containing 5 sequences into three files. Three output FASTA are created: two containing 2 sequences and one containing 1 sequence.

Input:

>Sequence1
ACTG
>Sequence2
ACTGACTG
>Sequence3
ACTGACTGACTG
>Sequence4
ACTGACTGACTGACTG
>Sequence5
ACTGACTGACTGACTGACTG

Output 1:

>Sequence1
ACTG
>Sequence2
ACTGACTG

Output 2:

>Sequence3
ACTGACTGACTG
>Sequence4
ACTGACTGACTGACTG

Output 3:

>Sequence5
ACTGACTGACTGACTGACTG
Fixed number of sequences per defined number of files

The following example shows how to split an input FASTA file with five sequences into three files containing one sequence.

Input:

>Sequence1
ACTG
>Sequence2
ACTGACTG
>Sequence3
ACTGACTGACTG
>Sequence4
ACTGACTGACTGACTG
>Sequence5
ACTGACTGACTGACTGACTG

Output 1:

>Sequence1
ACTG

Output 2:

>Sequence2
ACTGACTG

Output 3:

>Sequence3
ACTGACTGACTG

Note how input order is kept in the three output FASTA files that are created. If the ‘Randomize’ option is used, the following output with sequences in a random order can be obtained.

Output 1:

>Sequence2
ACTGACTG

Output 2:

>Sequence5
ACTGACTGACTGACTGACTG

Output 3:

>Sequence1
ACTG

Finally, if you want to obtain three FASTA files with three sequences each you need to use the ‘Independent extractions’ option. This option is usually combined with the ‘Randomize’ option. By doing this, the following output could be obtained.

Output 1:

>Sequence2
ACTGACTG
>Sequence5
ACTGACTGACTGACTGACTG
>Sequence4
ACTGACTGACTGACTG

Output 2:

>Sequence5
ACTGACTGACTGACTGACTG
>Sequence1
ACTG
>Sequence3
ACTGACTGACTG

Output 3:

>Sequence1
ACTG
>Sequence4
ACTGACTGACTGACTG
>Sequence2
ACTGACTG

Translate

This operation allows to translate nucleic acid sequences to their corresponding peptide sequences. It can translate to the three forward and three reverse frames, and output multiple frame translations at once.

The configuration panel allows to specify:

  • The frame in which translation should start. You can choose between:
    • Starting at fixed frame: by selecting this option, sequences are translated starting at the specified frame.
    • Considering frames 1, 2 and 3: by selecting this option, three translations starting at frames 1, 2 and 3 are created.
  • Use a custom codon code: this option allows selecting a file containing a custom DNA codon table. This option is unselected by default and in this case SEDA uses the standard genetic code. A custom codon code must be given in the following format:
TTT=T
CTT=C
GCA=A
  • Use reverse complement sequences: whether reverse complement of sequences must be calculated before translation or not. If not selected, sequences are used as they are introduced and therefore the three forward frames are obtained. If selected, the three reverse frames are obtained.
_images/125.png

Examples

The following example shows how sequences are translated in the three frames without using the reverse complement sequences. Note that stop codons are marked with an *.

Input:

>Sequence1
TTCCTTTGTCGCAGGGGG
>Sequence2
GGAGATGACCACTCG

Output_frame_1:

>Sequence1
FLCRRG
>Sequence2
GDDHS

Output_frame_2:

>Sequence1
SFVAG
>Sequence2
EMTT

Output_frame_3:

>Sequence1
PLSQG
>Sequence2
R*PL

The following example shows how sequences are translated in the three frames using the reverse complement sequences.

Input:

>Sequence1
TTCCTTTGTCGCAGGGGG
>Sequence2
GGAGATGACCACTCG

Output_frame_1:

>Sequence1
PPATKE
>Sequence2
RVVIS

Output_frame_2:

>Sequence1
PLRQR
>Sequence2
EWSS

Output_frame_3:

>Sequence1
PCDKG
>Sequence2
SGHL

Reformatting

Disambiguate sequence names

This operation allows to disambiguate duplicated sequence names (identifiers). The configuration panel allows to choose the way of disambiguating them: Rename, to add a numeric prefix to disambiguate duplicate names, or Remove, to remove sequences with duplicate identifiers, keeping the first occurrence.

_images/126.png

The following example shows how sequences with duplicate names in the input FASTA are removed (in the Removed Output FASTA) or renamed to avoid those redundancies (in the Rename Output FASTA).

Input:

>SequenceA
ATGGTCCATG
>SequenceA
ATGGGCTAAC
>SequenceB
ATGGGGCCAC
>SequenceB
ATGGCCAACC
>SequenceC
CCCCTTTGGG

Remove Output:

>SequenceA
ATGGTCCATG
>SequenceB
ATGGGGCCAC
>SequenceC
CCCCTTTGGG

Rename Output:

>SequenceA_1
ATGGTCCATG
>SequenceA_2
ATGGGCTAAC
>SequenceB_1
ATGGGGCCAC
>SequenceB_2
ATGGCCAACC
>SequenceC
CCCCTTTGGG

NCBI rename

This operation allows to replace NCBI accession numbers in the names of FASTA files by the associated organism name and additional information from the NCBI Taxonomy Browser (https://www.ncbi.nlm.nih.gov/Taxonomy/). An example of a FASTA file could be ‘GCF_000001735.3_TAIR10_cds_from_genomic.fna’. When this file is given to this operation, the organism name associated to the accession number ‘GCF_000001735.3’ is obtained from the NCBI (https://www.ncbi.nlm.nih.gov/assembly/GCF_000001735.3). In this case, the ‘Arabidopsis thaliana (thale cress)’ is the associated organism name. The ‘File name’ allows specifying how this name is added to the file name and the ‘Delimiter’ parameter specifies if a separator should be set between the name and the file name. You can choose between one of the following ‘Position’ values:

  • Prefix: before the actual file name. In the example, with ‘Delimiter’ = ‘_’, the output FASTA would be named ‘Arabidopsis thaliana (thale cress)_GCF_000001735.3_TAIR10_cds_from_genomic.fna’.
  • Suffix: after the actual file name. In the example, with ‘Delimiter’ = ‘_’, the output FASTA would be named ‘GCF_000001735.3_TAIR10_cds_from_genomic.fna_Arabidopsis thaliana (thale cress)’.
  • Override: entirely replacing the actual file name. In the example, the output FASTA would be named ‘Arabidopsis thaliana (thale cress)’.
  • Replace: replacing the accession number. In the example, the output FASTA would be named ‘Arabidopsis thaliana (thale cress)_TAIR10_cds_from_genomic.fna’.
  • None: not modifying the file name.
_images/127.png

In addition to modifying the name of the FASTA files, this operation can also add this information to the sequence headers. This is configured in the ‘Sequence headers’ area shown below. This option does the same than the ‘Add prefix/suffix‘ rename mode of the Rename header operation (see section Add prefix/suffix), being the organism name the string to add to the sequence headers.

_images/215.png

Moreover, some general configuration parameters can be specified in the ‘Configuration’ area. These parameters are:

  • Replace blank spaces: whether blank spaces must be replaced or not.
  • Replace special characters: whether special characters must be replaced or not. Special characters are ‘<‘, ‘>‘, ‘:‘, ‘‘, ‘/‘, ‘|‘, ‘?‘, and ‘*‘.
  • Replacement: the replacement string for those special characters.
  • Save replacements map: whether the replacements map must be saved or not. This is useful to know how accession numbers have been replaced.
  • File: the file to save the replacements map.
_images/39.png

Finally, this operation also allows obtaining additional information from the NCBI Taxonomy. The ‘NCBI Taxonomy information’ panel allows choosing what fields should be added to the organism name when applying the operation. Fields are added with the ‘Delimiter’ as separator. For instance, the accession number ‘GCF_000001735.3’ has this information page: https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?mode=Info&id=3702. If you select ‘Kingdom’, then the string associated to it would be ‘Arabidopsis thaliana (thale cress)_Viridiplantae’. Note that some accession numbers or organisms may not have available information for all fields. In that case, those fields are ignored.

_images/45.png

Reallocate reference sequences

This operation allows to find one or more sequences (i.e. your reference sequences) using a pattern filtering option and reallocate them at the beginning of the file. For instance, this operation is useful to place at the beginning of your FASTA files the reference sequence or sequences and specify them in the ‘Remove by size difference’ filtering operation.

_images/128.png

The configuration of this operation is the same as the Pattern filtering configuration. Thus, you may refer to Pattern filtering section to learn how to use it.

Examples

The following example shows how an input FASTA file is processed to reallocate those sequences containing ACTG at the beginning of the file.

Input:

>Sequence1
AGGGTTTAGCCAACGCCTGCAGCA
>Sequence2
AGGGTTTAGCCAACTGCTGCAGCA
>Sequence3
CTACTGGAATAGAACCTCTGGAAT
>Sequence4
CTATGGAATAGAACCTCTGGAATC

Output:

>Sequence2
AGGGTTTAGCCAACTGCTGCAGCA
>Sequence3
CTACTGGAATAGAACCTCTGGAAT
>Sequence1
AGGGTTTAGCCAACGCCTGCAGCA
>Sequence4
CTATGGAATAGAACCTCTGGAATC

The following example shows how an input FASTA is processed to reallocate those sequences containing Homo_Sapiens in their headers at the beginning of the file.

Input:

>Mus_musculus
TGCCAGAGAACTGCCGGTGTGGTG
>Pan_paniscus
ATGTCTTCCATTAAGATTGAGTGT
>Homo_sapiens
GCACCAGGGGGCCCTGTACTCCCT
>Falco_cherrug
CGCGCAGCCGTCTTTGACCTTGAT

Output:

>Homo_sapiens
GCACCAGGGGGCCCTGTACTCCCT
>Mus_musculus
TGCCAGAGAACTGCCGGTGTGGTG
>Pan_paniscus
ATGTCTTCCATTAAGATTGAGTGT
>Falco_cherrug
CGCGCAGCCGTCTTTGACCTTGAT

Reformat file

This operation allows to change the format of a FASTA file. This format includes:

  • Fragment length: the fragment length or number of columns in which sequences are divided. The ’Remove line breaks’ option specifies that sequences should not be fragmented.
  • Line breaks: the type of line breaks, which can be ‘Windows‘ or ‘Unix‘.
  • Case: the case of the sequences. ‘Original‘ means that original case in input sequences is kept and ‘Lower case’ and ‘Upper case’ allows converting sequences to lower or upper case bases respectively.
_images/129.png

Examples

The following example illustrates how line breaks are removed from the input FASTA sequences by using this operation with the ‘Remove line breaks’ option selected.

Input:

>Sequence1
ACTG
ACTG
AC
>Sequence2
ACTGACTG
ACTGA

Output:

>Sequence1
ACTGACTGAC
>Sequence2
ACTGACTGACTGA

The following example illustrates how the length of the input FASTA sequences is set to 4.

Input:

>Sequence1
ACTGACTGAC
>Sequence2
ACTGACTGACTGA

Output:

>Sequence1
ACTG
ACTG
AC
>Sequence2
ACTG
ACTG
ACTG
A

Rename header

This operation allows to modify the sequence headers in different ways. These ways are specified in the ‘Rename type’ parameter, which allows choosing between: Multipart header, Replace word, Replace interval and Add prefix/suffix. Each of these methods is explained below.

Common to all these methods is the ‘Target’ parameter, which allows to specify which part of the sequence headers must be processed: Name, to process only the sequence identifier; Description, to process only the description part of the header; or All, to process both name and description together.

_images/130.png

If a file selection has been done, the ‘Rename preview’ area shows you a preview of the current configuration applied to the first sequence of the first selected file.

Multipart header

The ‘Multipart header’ rename allows to split the sequence header into fields delimited by the characters specified in the ‘Field delimiter’ parameter. Then, you can select which fields you want to keep or remove and which delimiter (‘Join delimiter’ parameter) should be used to create the new sequence header. Note that when the ‘Keep‘ mode is used, then the order of the fields is preserved in the output, meaning that it is possible to swap fields using this feature.

_images/216.png

As an example, consider that you have a set of sequences that have the following header structure:

>SequenceIdentifier [field1=value] [field2=value] [field3=value] [field4=value]

As you can see, fields are separated by a blank space. Thus, this rename mode is useful to remove those fields you are not interested in. The following example shows how only field4 is kept in the output fasta. The configuration applied to do this should be: ‘Target’ = ‘Description’, ‘Field delimiter’ = ‘ ‘, ‘Join delimiter’ = ‘ ‘, ‘Mode’ = ‘Keep’, ‘Fields’ = ‘4’.

Input:

>Sequence1 [field1=1.1] [field2=1.2] [field3=1.3] [field4=1.4]
ACTG
>Sequence2 [field1=2.1] [field2=2.2] [field3=2.3] [field4=2.4]
ACTG
>Sequence3 [field1=3.1] [field2=3.2] [field3=3.3] [field4=3.4]
ACTG

Output:

>Sequence1 [field4=1.4]
ACTG
>Sequence2 [field4=2.4]
ACTG
>Sequence3 [field4=3.4]
ACTG

Replace word

The ‘Replace word’ rename mode allows to replace one or more words (‘Targets’ parameter) by a ‘Replacement’ word. Moreover the ‘Regex’ parameter allows to specify whether target words should be evaluated as regular expressions or not (see section Regular expressions to know how to define regular expressions).

_images/310.png

As an example, consider that you have a set of sequences that have the following header structure:

>SequenceIdentifier [gen=value] [protein=value]

As you can see, there are two description fields providing information about gene and protein. Thus, this rename mode is useful to remove those words and keep only the actual information values. The following example illustrates this process. The configuration applied to do this should be: ‘Targets’ = [‘[gen=’, ‘[protein=’, ‘]’ ], ‘Regex’ = ‘not selected‘, ‘Replacement’ = ‘’.

Input:

>Sequence1 [gen=genA] [protein=proteinA.1]
ACTG
>Sequence2 [gen=genB] [protein=proteinB.2]
ACTG
>Sequence3 [gen=genC] [protein=proteinC.3]
ACTG

Output:

>Sequence1 genA proteinA.1
ACTG
>Sequence2 genB proteinB.2
ACTG
>Sequence3 genC proteinC.3
ACTG

Replace interval

The ‘Replace interval’ rename mode allows to replace an interval delimited by two words (‘From’ and ‘to’) by a ‘Replacement’ word.

_images/46.png

As an example, consider that you have a set of sequences that have the following header structure:

>SequenceIdentifier [gen=value] / some automatically generated information / [protein=value]

As you can see, there are two description fields providing information about gene and protein and some information delimited by ‘/’. Thus, this rename mode is useful to remove this interval. The following example illustrates this process. The configuration applied to do this should be: ‘From’ = ‘ / ’, ‘To’ = ‘‘ / ’, ‘Replacement’ = ‘[DELETED]’.

Input:

>Sequence1 [gen=genA] / some automatically generated information / [protein=proteinA.1]
ACTG
>Sequence2 [gen=genB] / some automatically generated information / [protein=proteinB.2]
ACTG
>Sequence3 [gen=genC] / some automatically generated information / [protein=proteinC.3]
ACTG

Output:

>Sequence1 [gen=genA] [DELETED] [protein=proteinA.1]
ACTG
>Sequence2 [gen=genB] [DELETED] [protein=proteinB.2]
ACTG
>Sequence3 [gen=genC] [DELETED] [protein=proteinC.3]
ACTG

Add prefix/suffix

The ‘Add prefix/suffix’ rename mode allows to add the word specified in the ‘String’ parameter to the sequence headers. This word can be added in three positions (‘Position’ parameter): Prefix, that is, before the part of the header to modify; Suffix, that is, after the part of the header to modify; or Override, that is, entirely replacing the part of the header to modify. This mode has the following additional parameters:

  • Delimiter: the delimiter between the word to add and the header. Note that the word to add also includes the index.
  • Add index: whether an index should be added to the defined word or not.
  • Index delimiter: the delimiter between the word to add and the index number.
_images/53.png

As an example, consider that you are interested in adding the word ‘Sequence’ delimited by a ‘_’ with an index delimited by a ‘_’. The resulting word can be added as prefix, suffix or overriding the entire header. For the sake of simplicity, input sequences do not contain a description in their headers.

Input:

>Homo_Sapiens_NP.00097
ACTG
>Homo_Sapiens_NP.00198
ACTG
>Homo_Sapiens_NP.02004
ACTG

Output (Prefix):

>Sequence_1_Homo_Sapiens_NP.00097
ACTG
>Sequence_2_Homo_Sapiens_NP.00198
ACTG
>Sequence_3_Homo_Sapiens_NP.02004
ACTG

Output (Suffix):

>Homo_Sapiens_NP.00097_Sequence_1
ACTG
>Homo_Sapiens_NP.00198_Sequence_2
ACTG
>Homo_Sapiens_NP.02004_Sequence_3
ACTG

Output (Override):

>Sequence_1
ACTG
>Sequence_2
ACTG
>Sequence_3
ACTG

Sort

This operation allows to sort sequences. Sort can be made based on sequence headers or on the content of the sequences. You can choose between two criteria to sort them: length or alphabetical. By default, sequences are sorted in ascending order (e.g. the shortest sequence in the first place). The ‘Descending’ option allows to sort sequences in descending order (e.g. the longest sequence in the first place).

_images/131.png

Examples

The following example shows an input FASTA file sorted by sequence length (i.e. number of bases) in descending order.

Input:

>Sequence1
ACTGACTGAC
>Sequence2
ACTGACTGACTGA
>Sequence3
ACTG
>Sequence4
ACTGACTGACTGACTG

Output:

>Sequence4
ACTGACTGACTGACTG
>Sequence2
ACTGACTGACTGA
>Sequence1
ACTGACTGAC
>Sequence3
ACTG